New Hires Essay Example for Free

New Hires EssayIntroductionCarl Robins, who is a innovative recruiter for ABC Inc., hired 15 unfermented trainees with the intention to have them take down on June 15th. As the first date perplexs closer, Carl discovers that all the trainees are non prepared to start their troth. Most of them do not have all the paperwork required for employment and no(prenominal) of them have visited the clinic for their penuryful drug screening. Carl needs to contact the untested recruits immediately so they can plump out all the prerequisites for employment. Also, Carl needs to get in contact with someone for more training on the applicant hire and training process.BackgroundCarl Robins is a cutting employee with ABC Inc. He has barely been with the ships company for six months and has just experienced his first hiring process. Carl hired 15 new employees thinking they would be able to go through training on June 15th and begin working sometime in July. After Memorial Day, Car l was reviewing all the paperwork for the new hires. He discovered that none of them are ready to start on June 15th. Some of the applicants did not have their applications completely filled out and some of them were wanting transcripts, also none of them had their mandate drug screenings done. Furthermore, all but three of the orientation manuals were missing and he found out that the training room was schedule all through June. key ProblemsSome of the key problems are that the new hires are not prepared for their start date of June 15th. It is the responsibility of the recruiter that the new hires are completely ready for their start date and have everything they need in order to be successful in the company. The recruiter is responsible for the two main problems. The fact that Carl is a new employee himselfcould shorten the fact that none of the new hires are ready for their orientation start date.AlternativesA recommendation for Carl would be to search around his office for all the missing paperwork as it could have just been misplaced. Also, some of the new hires could have completed the drug screening he just hasnt seen the results of them yet. However, he should only pop off a few hours looking for the missing paperwork as time is running short. Another solution would be for Carl to set back the start date for the new employees since the training room is booked for the whole month of June. This alternative is not recommended however be compositors case it will set back the new hires a month as they will not be able to start until August. Also, Monica is counting on the new employees starting in July. This solution would also be harmful because Carl is quench new to the company and having to push the start date back a month because of a few mistakes he made would not look near in managements eyes. Carl should also remind the new employees of the companys drug policy and that if any of them were to fail the drug screening their employment would be terminated immediately.Carl could also push back the start date from June to July to give himself more time to prepare the paperwork, also the training room is booked for the entire month of June. He has the option to get in contact with all the recruits and assure that they get all the missing paperwork in and get to the clinic for their mandatory drug test. Not only do the new recruits need to take a drug test but they also need to pass the drug screening in order to be fully hired into the company.Also, Carl waiting until the last minute to review their paperwork added fuel to the fire and only made matters worsened for everyone. If he reviewed all the applications ahead of time, it would have given him plenty of time to make sure all the paperwork was put together properly and all the exam was done. With this being Carls first time doing the recruiting process for this company he might not be familiar with the rules and hiring process itself. Carl seems to be the root cause of the new hires not being ready for their start date of June 15th.Proposed SolutionCarl should contact all new hires immediately to make sure that all the requirements for the company are met and that all the new hires are preparedfor their start date before it approaches. Monica is really counting on these new recruits beginning their work in July and not just starting their training in July. If the date of orientation had to be pushed back, it would reflect poorly on Carl and he might get in some trouble with management over it.RecommendationsApparently Carl was not clear on all the hiring procedures of a recruiter. It is recommended for Carl to get retrained on the hiring and training process of new recruits. Getting retrained will hopefully ensure that this problem never happens again. It is also recommended that Carl talk to Monica about a new place to hold the orientation because the orientation room is already booked. Him and Monica need to sit down a figure out a place to hol d the orientation that would be big comme il faut to fit all 15 new hires.ConclusionIn conclusion, careful research has been done on what alternative methods should be taken to ensure Carl get everything completed and ready for the new hires start date. A lot of thinking has gone into this paper and I have attempted to think of every assertable solution to Carls predicament. It is apparent that Carl may have had too much to deal with for his first time dealing with the recruiting process to effectively complete his duties as a recruiter for the company. Carl should have had a checklist with his and made himself a timeline for when everything had to be completed.It was analyzed that Carl could either push back the date of the orientation to July which is not highly recommended and should only be used as a last resort, or Carl should immediately get in contact with the new recruits and help them get all the paperwork they need ready for the start date. If they cant drop it off at th e office Carl should ensure that it either be faxed or mailed to him before the start date of June 15th. If Carl had a checklist and ensured everything was filled out and completed beforehand he could have done his main job which is finding the best employees for the company.

Motivation Theories Essay Example for Free

Motivation Theories EssayContent theories of need are based on the item that the labor activity of workers due solely to the needs and focus on their identification. In turn, procedural theories of need are based on the fact that behavior of an individual is determined not only by a persons needs, but also by the wisdom of the spatial relation, expectations for the capacity, as well as the effects of the selected type of behavior, according to Motivation.Needs. It should be noted that Abraham Maslow recognized that people have many different needs and they could be divided into fiver main categories he theory of justice expectations. According to this theory, the results achieved by the employee depend on three variables the effort, the ability of a persons character and awareness of its role in the labor deal. The direct of effort, in turn, depends on the value of interest and assesses the likelihood of relations efforts and rewarded. Achieving the desired results can lead to internal rewards of the satisfaction of the work performed, and impertinent rewards financial incentives, praise, career, etc.It is also believed that there may be a link between performance and employee to give him rewards that reflect the possibilities determined by the chieftain of a particular employee and the organization. Value theory by L. Porter E. Lawler in the practice of motivation is that it shows how important it is to create a motivational system to cartel elements such as effort, ability, results, reward, satisfaction and perception. Furthermore L. Porter E. Lawler showed that the high productivity of work is the come of complete satisfaction, rather than a consequence of it.An important closing of this theory is the need to change the employees salary, depending on the success of his work. According to the theory of justice, people have their own assessment of the equity interest issued for certain results. mirth is the result of internal and extern al rewards based on their equity. Satisfaction is a measure of how valuable reward actually is. This assessment will affect the persons perception of future situations.Motivational concepts that are also enough known are related to a group of content theories are the theory of David McClelland, in which he focuses on the needs of the higher levels power, success and involvement. On this basis, according to McClelland, there is a fourth requirement to avoid trouble, obstacles or opposition to the implementation of the preceding(prenominal) three requirements. Motivational and hygienic model of F. Herzberg. It is widely known among scholars and practitioners was another model of motivation, developed F.Hertzberg with employees in the mid 50-ies of XX century and known as the two-factor theory of hygiene. As hygiene factors, he took the following company policy and administrationworking conditions earnings interpersonal relationships with superiors, colleagues and subordinates degre e of direct control everywhere the work. Motivation, according to F. Herzberg, is achievement of objectives, promotion, high level of responsibility and autonomy, creative and business growth, recognition, interesting content work. According to F.Herzberg hygiene factors themselves are not a cause for satisfaction, but their degradation leads to dissatisfaction with work, according to Frederick Herzbergs motivation and hygiene factors. Therefore, these factors are not motivating for employees value. Group motivators directly cause job satisfaction and affect the level of labor achievements. The theory of five nuclear factors by Hackman and Oldham. In the 70-ies of XX century was published a review of Hackman and Oldham the impact of the content of labor to deem motivation.Developing the doctrine F. Herzberg, in their model, they identified five so-called nuclear factors, which, to them, a significant effect on work motivation. In accordance with the moroseness of these factors in the ordinary activities of the employee, they lead to the specific experiences that Hackman and Oldham called critical mental states. Group theory of valence-instrumentality expectations includes concepts of Heinz Heckhausen, Vroom and a number of similar theories relating to procedural learning motivation towards work behavior.Common to these theories is the proposition that there is a requirement not only requirement motivation. People consciously choose a course of post which, in their view, would lead to the desired results. These theories try to explain what objectives are formed, and why, how persistent they are pursued to achieve the expected results. The theory of Justice S. Adams. The group process of theories of motivation is aimed at organizational problems of production, the substance of the work, and is to be widely used in the western management theory of justice, developed in the 60 days of XX century.Adams, on the results of studies conducted in the company Gener al-Electric. This theory postulates the search for the individual a certain state of equilibrium with its social environment (in particular, in wrong of evaluation and pay, rewards for achievement). Individual compares two relationships the relationship between his own effort and reward same ratio, seen in monitoring the activities of others and to compare with their own efforts and reward. The theory of motivation of D. Atkinson.One of the theories is a process known as the theory of motivation of D. Atkinson, the essence of which is as follows. Employee behavior is the result of the interaction of the individual qualities of the individual and the situation of its perception. Each person strives for success, avoids failure and has two related motives the motive for success and motivations to avoid failures. The theory of reinforcement B. Skinner. A significant contribution to the study of the mechanisms of charitablee motivation to work made development of B.Skinner, who propos ed the theory in 1938, increase motivation (reinforcement theory), the essence of which is as follows peoples behavior is determined by their past experiences. Consequently, workers select a mission that in the past entailed positive results, according to Theories of Motivation. All in all, there are many motivational theories and many authors who have shown their mentation considering the issue. Lyman Porter and Edward Lawler, Maslow, Atkinson Heckhausen, and Hackman and Oldham have different point of view but all of them have something in common.The theories of motivation describe the reasons and personal development that a human has and expands its potential, as well as the need for self-actualization that can never be fully satisfied. Works cited Abraham Maslows Hierarchy of Needs motivational model.

Water Conservation Essay Example for Free

Water Conservation EssayUnited States postal stamp advocating piss saving.Water conservation encompasses the policies, strategies and activities to manage fresh body of water as a sustainable resource, to protect the water environment, and to meet current and future human demand. Population, household size and egression and affluence all affect how much water is used. Factors such as climate change will increase pressures on natural water resources in particular in manufacturing and plain irrigation.1The goals of water conservation efforts includeTo ensure availability for future generations, the withdrawal of fresh water from an ecosystem should not exceed its natural reclamation rate. Energy conservation. Water pumping, delivery and waste water treatment facilities consume a signifi houset amount of energy. In some regions of the world over 15% of total electricity consumption is devoted to water attention. Habitat conservation. Minimizing human water use inspection and repairs to preserve fresh water habitats for local wildlife and migrating waterfowl, as fountainhead as reducing the need to build newdams and other water diversion infrastructures.Contentshide1 Strategies2 Social solutions3 Household applications4 technical applications5 Agricultural applications6 See also7 References8 External linksStrategieseditIn implementing water conservation principles there ar a number of key activities that may be beneficial. 1. Any beneficial reduction in water loss, use and waste of resources. 2. Avoiding any damage to water quality.3. upward(a) water management practices that strangle or enhance the beneficial use of water.23 Social solutionseditDrip irrigation system in New MexicoWater conservation programs affect in social solutions are typically initiated at the local level, by either municipal water utilities or regional governments. Common strategies include state-supported outreach campaigns,4 tiered water rates (charging progressively h igher prices as water use increases), or restrictions on outdoor water use such as lawn lacrimation and car washing.5 Cities in dry climates often require or encourage the installation of xeriscaping or natural landscaping in new homes to reduce outdoor water usage.6 One fundamental conservation goal is universal metering. The prevalence of residential water metering varies significantly worldwide. Recent studies have estimated that water supplies are metered in less than 30% of UK households,7 and about 61% of urban Canadian homes (as of 2001).8 Although individual water meters have often been considered impractical in homes with private come up or in multifamily buildings, the U.S.Environmental Protection Agency estimates that metering alone can reduce consumption by 20 to 40 percent.9 In addition to elevator consumer awareness of their water use, metering is also an important way to identify and localize water leakage. Water metering would benefit society in the long run it is turn out that water metering increases the efficiency of the entire water system, as well as help unnecessary expenses for individuals for years to come. One would be unable to waste water unless they are willing to pay the extra charges, this way the water department would be able to monitor water usage by public, domestic and manufacturing services. several(prenominal) researchers have suggested that water conservation efforts should be primarily directed at farmers, in light of the fact that crop irrigation accounts for 70% of the worlds fresh water use.10The agricultural sector of close countries is important both economically and politically, and water subsidies are common. Conservation advocates have urged removal of all subsidies to force farmers to grow more water-efficient crops and gull less wasteful irrigation techniques. New technology poses a few new options for consumers, features such and full flush and half flush when development a fanny are trying to make a di fference inwater consumption and waste. Also available in our modern world is shower heads that help reduce wasting water, old shower heads are said to use 5-10 gallons per minute. All new fixtures available are said to use 2.5 gallons per minute and poke out equal water coverage.Household applicationseditThe Home Water Works website contains useful information on household water conservation.11 Contrary to popular view, experts suggest the most efficient way is replacing toilets and retrofitting washers.12 Water-saving technology for the home includes1. Low-flow shower heads sometimes called energy-efficient shower heads as they also use less energy 2. Low-flush toilets and composting toilets. These have a dramatic impact in the developed world, as conventional Western toilets use large volumes of water 3. Dual flush toilets created by C smelling includes two buttons or handles to flush different levels of water. Dual flush toilets use up to 67% less water than conventional toile ts 4. Faucet aerators, which break water flow into fine droplets to maintain wetting effectiveness while using less water. An additional benefit is that they reduce splashing while washing reach and dishes 5. Raw water flushing where toilets use sea water or non-purified water 6. Waste water reuse or recycling systems, allowingReuse of graywater for flushing toilets or watering gardens Recycling of wastewater through purification at a water treatment plant. See also Wastewater Reuse7. Rainwater result8. High-efficiency apparel washers9. Weather-based irrigation controllers10. Garden water nozzles that shut off water when it is not being used, instead of letting a hose run.11. Low flow taps in wash basins12. Swimming pool covers that reduce evaporation and can warm pool water to reduce water, energy and chemical costs. 13. Automatic faucet is a water conservation faucet that eliminates water waste at the faucet. It automates the use of faucets without the use of hands. Commercia l applicationseditMany water-saving devices (such as low-flush toilets) that are useful inhomes can also be useful for business water saving. Other water-saving technology for businesses includesWaterless urinalsWaterless car washesInfrared or foot-operated taps, which can save water by using short bursts of water for rinsing in a kitchen or bathroom Pressurized waterbrooms, which can be used instead of a hose to clean sidewalks X-ray film processor re-circulation systemsCooling tower conductivity controllersWater-saving steam sterilizers, for use in hospitals and health care facilities Rain water harvestingWater to Water heat exchangers.Agricultural applicationseditOverhead irrigation, center pivotdesignFor crop irrigation, optimal water efficiency means minimizing losses due to evaporation, runoff or subsurface drainage while maximizing production. An evaporation pan in combination with specific crop correction factors can be used to regularize how much water is needed to satisfy plant requirements. Flood irrigation, the oldest and most common type, is often very uneven in distribution, as parts of a field may receive excess water in order to deliver sufficient quantities to other parts. Overhead irrigation, using center-pivot or lateral-moving sprinklers, has the potential for a much more equal and controlled distribution pattern. Drip irrigation is the most expensive and least-used type, but offers the ability to deliver water to plant roots with minimal losses.However, throw off irrigation is increasingly affordable, especially for the home gardener and in light of rising water rates. There are also cheap effective methods similar to drip mould irrigation such as the use of soaking hoses that can even be submerged in the growing medium to eliminate evaporation. As changing irrigation systems can be a costly undertaking, conservation efforts often concentrate on maximizing the efficiency of the existing system. This may include chiseling compacted soils , creating furrow dikes to prevent runoff, and using soil moisture and rainfall sensors to optimize irrigation schedules.9Usually large gains inefficiency are possible through measurement and more effective management of the existing irrigation system. The 2011 UNEP Green Economy Report notes that improved soil organic matter from the use of green manures, mulching, and recycling of crop residues and animal manure increases the water retentiveness capacity of soils and their ability to absorb water during torrential rains, 13 which is a way to optimize the use of rainfall and irrigation during dry periods in the season.

The Importance Of Imaginary Places

The Importance Of Imaginary PlacesId like to begin my es narrate from one point of reference that helped me to understand the main direction of this work discussion. This quotation explains the main content of the legal opinion imaginary places and their meaning for nation. Lets look at it attentively and analyze how the terra firma Trade Center site in New York City is now an imaginary place. Leonard Mcclure stated that Such sites are, of course, actual places. We loafer go there today, stand, look, and sleep together we are in the place. Yet, at the same time, these actual places are mythic because they embody meanings far beyond the scope of the events that happened and even beyond the limits of the physical locations themselves. In that sense, they are imaginary places. (Leonard Mcclure, 2003)I want to mention in this paragraph that such imaginary places are very important for 21st century Ameri send packings. In our consciousness the notion imaginary place squirt be i nterpret as a place that exists only in idea, it can be desire of one person or it can be inclination of group of people, who are interested in one problem or question besides imaginary place is a place said to exist in fictional or religious writings. In our case it is one way outn website that reflects events that had a place in American society several years ago. The date of awful catastrophe will never be forgotten by people who lost there their relatives and I signify that the whole country will never forget that tragedy.Saying closely the World Trade Center (WTC) we can say that it was a complex in Lower Manhattan in New York City. In 2001 in the September 11 the World Trade Centers seven buildings were ruined by terrorist attacks. The site is at present being rebuilt with six new skyscrapers and a memorial to the casualties of the terrorist attacks. Now this website considered an imaginary place that exists as a variance of memory for people who know this place and fo r people who will never see beloved people. It will be very honest answer to say that people should remember their history and visiting imaginary places each(prenominal) people receive such possibility. Young people need to know how the place that they can see every day looked like several years ago and they should know its history. Old people can visit this place in their imagination and remember some events from their former(prenominal) manner.Imaginary places are important part of todays life, because everyday we are looking for something new and sometimes even forget nearly historical places and people who were connected with these places. It is a good idea to create imaginary places and it is also a good idea of creation of imaginary communities. Im not promoting against real places and real communities, but in my opinion people should have a chance to talk about their memories with people with the same interest and our past is the wonderful base for our future success and happiness.Id like to talk about imaginary communities in this paragraph as a component connected with the notion imaginary places. Famous American researcher Benedict Anderson named nations the imaginary associations. Imaginary as their representatives, not knowing the most compatriots, even never meeting them in time feel the involvement to them. By other words, imaginary associations exist in imagination of their members. Like imaginary places we cant visit in real life and touch to its things and ground where they based. Imagination is a really interesting notion, because it allows us to create something new and important, or unimportant, but pleasant it depends from our necessities and wishes. Role of imagination in the process of creative cognition it is possible to define as one of methods of the use of present for a man knowledge. The functions of imagination are probed in-process on run-in procedures of scientific cognition hypothesis, evident design, and mental experiment . The purpose of imagination is ability to create new appearances. It gives birth from necessities to correlate accessible to the man with that it is not habituated to him straight. It is understandable that for research of cognitive role of imagination it is necessary to scratch out its features. Complication of exposure of specific of imagination is conditioned that it closely interlaces with all types of cognition. This circumstance is reason of origin of tendency to the denial of existence of imagination as the special form of reflection. To decide this problem, it is necessary to expose actual genius of imagination. From all above stated determinations evidently, that the substantial sign of imagination is consider ability of subject to create new appearances. But it is not enough, because it is impossible consequently to conduct distinctions between imagination and thought. Creation of new knowledge and concepts in the field of logical thought can take place and without pa rticipation of imagination. Thus, we should take into account circumstance that imagination is creation of new appearances, and transformation of past experience, and what transformation is accomplished at organic unity distinct and rational.I think that imagination as a main aspect of imaginary places creation should be discussed with more details. We will consider specific forms of activity that is revealed in which perceptible reflection of reality, and also that role which execute feeling in the processes of forming of appearances. Very often feelings examined straight as valuable appearance of reality. Feelings primary appearances of certain properties of reality straight or indirectly join in forming of all (including generalized) mental appearances. Imagination, creating evident appearances, absorbs in itself feelings. But at it imagination leans against their semantic moment. Therefore, imagination physiological does not depend on activity of sense-organs. Imagination is product of transformation foremost of functional descriptions reflections. Perception is appearance of object on the whole, in it already very full semantic descriptions of subjectivity open up.During perception a subject is able to construct whole complexes directly not these parameters of object. The elements of imagination find out itself in a perceptible reflection only then, when along with ability functionally to finish building appearances these objects ability of man to expose is clearly revealed on your own functional meaningfulness of the perceived objects and to do this meaningfulness by the article of the special consideration and special procedures. Circumstance that in perception of persons capable from entropy separate to finish building elements the failings sides of object, see unit at to the real availability only its parts, testifies to development of subjective and active descriptions of perceptible appearances. Complexity such appearances, included in them experience individual and collective there is a display of nascent imagination activity. Essence of imagination consists in that appearances of imagination are consciously produced by a man.Thus, by a basic line which distinguishes imagination from different forms of activity in a perceptible reflection, there is current realized by the subject of imagination of human (social, cultural and other) grounds of this activity. The outer world comes forward the financial base of process of imagination in everything riches of its relations, from which the new impressions are dipped out and new images are created. Imagination can be examined and as a process (form) and as a result of (table of contents) reflection of objective to reality. It executes functions heuristic, anticipatory, practical, cognitive, aesthetic and others. Imagination is capable to transform the whole world without an exception. Imagination it one of capabilities man to product new images. By the feature of imaginati on as facilities transfer of knowledge from one area there is an original alloy on other perceptible and rational.Analyzing information about imagination as a form of our mind work we should emphasize that imagination is the specific reflection of reality and serves by the mean of its cognition. Activity of imagination necessarily flows in evident plan. It necessarily destroys a subject outside available situations, forms appearances, not having a direct original in to reality. Thus, based on our research data we can conclude that imaginary places allow people to be heterogeneous in imaginary activity and it also allows Americans to be involved in the history of their country, because it is necessary for all people remember what had happened in their country and I believe that such imaginary place also can help to avoid some catastrophes in future.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide ResistanceStudy of genetic salmagundi and QoI fungicide resistance in frogeye leaf spot (genus genus Cercospora sojina) from TennesseeIntroductionFrogeye leaf spot (FLS) of soybean (Glycine max Merr.), ca using upd by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928 Phillips 1999). FLS is an important foliar disease of soybean although symptoms poop appear on stems, pods, and seeds. There has been no report of the resource host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower come on of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a prima ry and secondary source of inoculum and are produced in infected leaves, stems, and pods. raw temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999).The United States is the wind producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http//faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008 Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008 Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was account in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991 Hartwig and Edwards Jr 1990 Laviolette et al. 1970 Mian et al. 1998).FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013 Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS guard methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, triad resistant genes Rcs (Resistant to C. sojina), have been deployed Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phill ips and Boerma 1982). The Rcs3 gene confers resistant against consort 5 and all known scats of C. sojina present in the USA. (Mengistu et al. 2012 Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent disease rigourousness in the field (Grau et al. 2004 Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease hardship (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be filling against QoI fungicides too (Athow and Probst 1952 Athow et al. 1962 Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to strike against sel ection pressure.Studies of C. sojina using several antennaes indicate sort among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of interrogation to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic renewing among isolates, although genetic constitutions did not cluster based on origin. (Bradley et al. 2012). Recen tly, a study of 132 isolates from Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013).The main objectives of this study were to access genetic diversity by developing and using novel SNP markers and dispersion of QoI resistant and clear isolates from Jackson and Milan, TN. attempt collection, Single-lesion Isolation, and deoxyribonucleic acid provokeionIn 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomize complete block construct with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A unity isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with dampish towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2).Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars.Cultivar IDCultivarsJacksonMilanTotal trea tedNon-treatedTreatedNon-treatedC1 volt-ampere Armor 37-R33 RR2171121453C2VAR Asgrow AG3832 GENRR2Y715201456C3VAR Becks 393R400033C4VAR trotlan R2C 39841913111457C5VAR Mycogen 5N393R2 RR2 g1220172877C6VAR Terral REV 39A351015131654C7VAR USG 73P93R226132162C8VAR Warren Seed 3780 R2Y It1422132675Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years.LocationNo. of SamplesYearJTN2032015MTN2342015AL52006AR52006FL12006GA42006IA12006IL22006/09LA12006MS62006SC22006/2009TN122007WI12006Note JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection.For desoxyribonucleic acid extraction, the single-lesion isolates were grown in 24-well deep well plates ( pekan Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as expound by Lamour and Finley (2006). Briefly, this includes harvesting mycelium f rom the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are s blanketpage dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device.SNP marker discovery and targeted-sequencing based genotypingWhole genome sequencing was polished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on a n Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All unresolved reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 were then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%.A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http//probes.pw.usda.gov/batchprimer3/) to amplify targets betwee n 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and investigate Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage.QoI resistant locus genotypingA single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (T hermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.).Mating types determinationA previously described multiplex PCR assay will be used to assign spousal relationship type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be incl uded with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp).Data AnalysisSNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess existence structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle orchestrate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic in dices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). nominal spanning networks (Bandelt et al. 1999) will be constructed with PopART (http//popart.otago.ac.nz/).Expected ResultsNovel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to mark off if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations.Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction.ReferencesAthow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12)660-662 pp.Athow KL, Pro bst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiologic race of Cercospora sojina on soybean. Phytopathology 52(7)712-714 pp.Bandelt H-J, Forster P and Rhl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1)37-48.Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of whole kit and boodle Pathology 34(3)410-416.Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health construct doi 10.Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6)465-468.Earl DA. 2012. STRUCTURE HARVESTER a website and course of study for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2)359-361.Grau CR, Dorrance AE, gravel J and Russ in JS. 2004. Fungal diseases. Soybeans Improvement, production, and uses(soybeansimprove)679-763.Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC.Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas Evidence for potential sexual reproduction. Phytopathology 103(10)1045-1051.Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4)418-419.Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9)811-833.Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10.Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11)1272-1272.Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9)1017-1021.Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean A review and proposed race designations for isolates of Hara. Crop science 48(1)14-24.Peakall R and Smouse PE. 2006. GENALEX 6 genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1)288-295.Phillips D. 1999. Frogeye leaf spot. collecting of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN20-21.Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7)764-766.Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population struc ture using multilocus genotype data. Genetics 155(2)945-959.Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6 molecular evolutionary genetics analysis version 6.0. Molecular biology and evolutionmst197.White TJ, Bruns T, downwind S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols a guide to methods and applications 18(1)315-322.Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 102008-2013.Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4)443-443.Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of benzoquinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic t ools for its identification. Plant Disease 99(4)544-550.Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10.Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5)767-767.

Descartes Say About Primary Qualities

Descartes Say About Primary QualitiesRene Descartes and John Locke both take a shit similar theories about primary qualities. They both hold the same survey on what is that primary qualities ar. Both of them believe that primary qualities have the motive to cause ideas in our minds. The main distinction between their theories lies in whether primary qualities ar perceived by means of the senses or by the soul.Rene Descartes believed that there argon two types of qualities, primary and secondary winding qualities. To Rene Descartes, primary qualities atomic number 18 those that argon clearly and clear perceived by us (33). These qualities ar those that exist due to their geometric integrity and which are related to some extension of a body in space. By this reasoning, Descartes believes these primary qualities are composed of anything that is measurable and goat have math applied to them such as motion, shape and size. Descartes believes that primary qualities are not misl eading like secondary qualities are. This is because the essence of secondary qualities is not geometric and indeed these qualities are perceived obscurely. Nevertheless both of these qualities produce ideas within us. The variance about the ideas produced by these qualities lie in whether it is clear and distinct or obscure and confused. The reason that these secondary qualities are often misleading and primary qualities are not is because we perceive both of these qualities differently.Descartes states that primary qualities, unlike secondary qualities, are perceived clearly and distinctly. This he beliefs, is due to the fact that our method that we go by perceiving these qualities is different. Primary qualities are perceived through our intellect as opposed to secondary qualities which are perceived through our senses (14). Descartes believes that our understanding comes through our intellect and not our senses, thence the ideas that we are able to grasp from primary qualitie s are not by means of our senses but rather by means of our intellect since they are clear and distinct unlike those ideas that come from our senses which are obscure and confused. Both primary and secondary qualities are perceived by the mind immediately and therefore result in the ideas we have (32). strange secondary qualities, primary qualities are features of the physical objects that are actually there but we come to understand the ideas produced by primary qualities solely by means of our intellect.Descartes uses the example of a thousand-sided figure to show how primary qualities produce these clear and distinct ideas compared to the often misleading ideas of secondary qualities (sixth meditation). He states that the imagination by means of the senses is able to generate an obscured and confused idea about a thousand sided figure in comparison to the intellect which is able to perceive it clearly no matter how many sides the figure has. These ideas, which are a product of p rimary qualities are related to extension and are therefore perceived by our intellect using our understanding (sixth meditation). Descartes theory on primary qualities has some similarity to John Lockes but differs on how it is that these ideas come to be about within us.John Lockes point of view regarding primary and secondary qualities is similar to some extent to Descartes theory of primary and secondary qualities. To Locke, primary qualities are spatiotemporal and quantitative. Therefore like Descartes, primary qualities are composed of size and shape, something which is measurable (135). Like Descartes, Locke believes that these qualities have the effect of producing the ideas that we have within us. An idea to Locke is the thought or understanding which is produced by the object. He calls the power that an object has to produce such ideas within us, qualities. Locke states that ideas are existent in our minds. To Locke these qualities are properties belonging to the objects a nd are the cause of the ideas that we house in our minds (134). The difference between primary qualities and secondary qualities to Locke is the kinds of ideas that these are able to produce in our minds. Locke believes that the ideas produced by primary qualities are a resemblance of these qualities. Locke believes that these qualities are actually existent in the objects themselves. On the other hand, those of secondary qualities hold no resemblance to them (136). Unlike Descartes, John Locke has a different theory by which we acquire these ideas.Unlike Descartes, John Locke believes that we acquire our ideas through the perception of the senses. According to Locke, reasoning is an exception to his posture on innate ideas. He believes that all of our ideas are acquired through our experiences and by means of our senses. Locke states how our mind is similar to that of a blank state, and it is only by experiences that we are able to perceive by means of our senses that we acquire t he ideas we possess. Qualities are the powers that objects have and it is within these powers that ideas are produced by them within us. Primary qualities are inseparable from the object, and thus the power of primary qualities produces ideas that resemble the object. This is shown by the example he gives of when something is divided even into its smallest of parts, even when these are too small for us to perceive, the primary qualities are still existent in the object (138).Although Descartes and Locke description of what primary qualities are is similar, their belief in how it is that we come to reason or reflect on these qualities is different. Descartes believes that we cant rely entirely on our senses, since they often deceive us. He believes that those ideas obtained from primary qualities are distinct and clear. Therefore he believes that the ideas produced by primary qualities are grasped by means of the intellect. Locke unlike Descartes believes that the ideas we acquire th rough our life is by experience and it is by the senses that we come to have such experiences. Therefore to Locke, the ideas produced by the power of primary qualities are grasped by means of the senses. To Locke and Descartes, primary qualities are the causal effect which produces the clear ideas that we have, the main difference between their theories is whether we obtain these through our senses and by reflecting or solely by the intellect.

A Tale of Two Heroes Essay -- Novels Enders Game Orsen Scott Card Ess

A Tale of Two Heroes Enders Game written by Orsen Scott Card and The Matrix the movie by Warner Brothers may not have much in common at least at first glance. There is much that the two charcters neo and Ender share. In fact one common theme in both their stories is the battle between free pass on and fate. Both Ender and Neo also share a battle between good and evil. Our heros also face a battle between themselves and their own desires. Neo who is our hero from The Matrix is a young human being who is seeking the truth about the matrix, a computer generated system. He encounters Morpheaus who becomes his guide and mentor in finding and then dealing with the truth about the matrix. Neo finds out that the matrix has control of the human race except a select few who have been freed from this computer generated dream world that controls them. The reality of humanness being used as battries to generate power for the machines does not come true for Neo until he is freed from the matrix . Through Morpheaus, Neo discovers that he could be the fullfilment of prognostication which promises a savior to free humanity from the matrix and end its reign over all mankind. Ender, on the other hand, is just a child when he is taken away from his family to be develop as a soldier to fight an alien civilization that is known as buggers. These buggers have invaded Earth double before and it is feared that they will invade again. It is believed that Ender is the only one who will be able to defeat the buggers. He is taken up into space to be trained at a battle discipline which teaches students the art of combat in space. Once he passes the tests that are set before him, Ender moves on to combat school where he learns to be a comandor and faces his last test... ...or small they may be. Both of our heros started off not thinking of themselves as heros but found that common farming between fate and free will where what we want to do and what we are meant to do colide. We all, even if we dont want to admit it, end up finding ourselves combat within our own desires and what we know we must do. If we are evil we will one day have to fight good and if we are good we will one day have to fight evil. As Ender and Neo found out that they were the ones to fight and win the battles that faced their lives we too can see that kindred Neo and Ender we to are the ones to fight the battles that face our lives. Later on in our heros stories we find Neo was not just the one but one of numerous ones and like Neo, Ender was just one of many ones. We two are just one of many ones. Enjoy fighiting your battles, pick them wisely, and fight them nobaly.